www.delorie.com/archives/browse.cgi   search  
Mail Archives: djgpp/2003/03/03/21:45:13

From: "Richard Thomas Harrison" <void AT black-hole DOT invalid>
Newsgroups: comp.os.msdos.djgpp
References: <17326N022 AT web2news DOT com>
Subject: Re: Vesa 2.0
Lines: 33
Organization: MIBnet
MIME-Version: 1.0
X-Priority: 3
X-MSMail-Priority: Normal
X-Newsreader: Microsoft Outlook Express 6.00.2720.3000
X-MIMEOLE: Produced By Microsoft MimeOLE V6.00.2600.0000
Message-ID: <MkU8a.10193$Lq.780558@stones>
Date: Tue, 4 Mar 2003 02:39:40 -0000
NNTP-Posting-Host: 195.166.145.95
X-Complaints-To: abuse AT plus DOT net DOT uk
X-Trace: stones 1046745516 195.166.145.95 (Tue, 04 Mar 2003 02:38:36 GMT)
NNTP-Posting-Date: Tue, 04 Mar 2003 02:38:36 GMT
To: djgpp AT delorie DOT com
DJ-Gateway: from newsgroup comp.os.msdos.djgpp
Reply-To: djgpp AT delorie DOT com

"Joel_S" <jbs30000 DOT news DOT invalid AT web2news DOT net> wrote in message
news:17326N022 AT web2news DOT com...
> Coppying the code from
> http://www.delorie.com/djgpp/doc/ug/graphics/vbe20.html
> When compiling, I get this error:
> Error: invalid conversion from `void*' to `VESA_PM_INFO*'
> What can I do to fix this?
> --
> Direct access to this group with http://web2news.com
> http://web2news.com/?comp.os.msdos.djgpp

It looks like you need

  #include <stdlib.h>

at the start of your code. This is for the 'malloc' on the line

  /* allocate space for the code stubs */
  vesa_pm_info = malloc(r.x.cx);

although I only got the warning

  test.c:53: warning: assignment makes pointer from integer without a cast

when I didn't have the include in the code.

Richard
--
------------------------------------------------------------------------
CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG
CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613                    (tm) rth @ mibnet.plus.com

- Raw text -


  webmaster     delorie software   privacy  
  Copyright © 2019   by DJ Delorie     Updated Jul 2019