www.delorie.com/archives/browse.cgi | search |
From: | "Richard Thomas Harrison" <void AT black-hole DOT invalid> |
Newsgroups: | comp.os.msdos.djgpp |
References: | <b2v0tc02dt0 AT enews4 DOT newsguy DOT com> |
Subject: | Re: call to 'open' causes all sleeping drives to awaken! |
Lines: | 29 |
Organization: | MIBnet |
MIME-Version: | 1.0 |
X-Priority: | 3 |
X-MSMail-Priority: | Normal |
X-Newsreader: | Microsoft Outlook Express 6.00.2720.3000 |
X-MimeOLE: | Produced By Microsoft MimeOLE V6.00.2600.0000 |
Message-ID: | <ed_4a.4490$Vx2.408580@wards> |
Date: | Thu, 20 Feb 2003 06:00:50 -0000 |
NNTP-Posting-Host: | 195.166.145.95 |
X-Complaints-To: | abuse AT plus DOT net DOT uk |
X-Trace: | wards 1045721034 195.166.145.95 (Thu, 20 Feb 2003 06:03:54 GMT) |
NNTP-Posting-Date: | Thu, 20 Feb 2003 06:03:54 GMT |
To: | djgpp AT delorie DOT com |
DJ-Gateway: | from newsgroup comp.os.msdos.djgpp |
Reply-To: | djgpp AT delorie DOT com |
"Sander Pool" <sander DOT biteme AT biteme DOT sanders-stuff DOT com> wrote in message news:b2v0tc02dt0 AT enews4 DOT newsguy DOT com... > Hello, > > I noticed when I used a program compiled with DJGPP that all sleeping drives > in my system spin up. I examined the code and it only uses the 'open' call > to create file descriptors. So I wrote a tiny test program: > ---8<--- > > PPS Win2K One thing I find is that XP keeps waking up my CDROMS just to check something is there. What's the whole point of Autorun then ? I have to keep a CD in both of the drives otherwise XP locks up the system for about 15 seconds and then returns control for about 10 seconds before locking up again. Sigh... I gonna have to get around to re-installing Linux. ;^) Richard -- ------------------------------------------------------------------------ CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG dna.pl v0.2.4 (c) 20020613 (tm) rth @ mibnet.plus.com
webmaster | delorie software privacy |
Copyright © 2019 by DJ Delorie | Updated Jul 2019 |