www.delorie.com/djgpp/mail-archives/browse.cgi   search  
Mail Archives: djgpp/2003/02/20/01:17:08

From: "Richard Thomas Harrison" <void AT black-hole DOT invalid>
Newsgroups: comp.os.msdos.djgpp
References: <b2v0tc02dt0 AT enews4 DOT newsguy DOT com>
Subject: Re: call to 'open' causes all sleeping drives to awaken!
Lines: 29
Organization: MIBnet
MIME-Version: 1.0
X-Priority: 3
X-MSMail-Priority: Normal
X-Newsreader: Microsoft Outlook Express 6.00.2720.3000
X-MimeOLE: Produced By Microsoft MimeOLE V6.00.2600.0000
Message-ID: <ed_4a.4490$Vx2.408580@wards>
Date: Thu, 20 Feb 2003 06:00:50 -0000
NNTP-Posting-Host: 195.166.145.95
X-Complaints-To: abuse AT plus DOT net DOT uk
X-Trace: wards 1045721034 195.166.145.95 (Thu, 20 Feb 2003 06:03:54 GMT)
NNTP-Posting-Date: Thu, 20 Feb 2003 06:03:54 GMT
To: djgpp AT delorie DOT com
DJ-Gateway: from newsgroup comp.os.msdos.djgpp
Reply-To: djgpp AT delorie DOT com

"Sander Pool" <sander DOT biteme AT biteme DOT sanders-stuff DOT com> wrote in message
news:b2v0tc02dt0 AT enews4 DOT newsguy DOT com...
> Hello,
>
> I noticed when I used a program compiled with DJGPP that all sleeping
drives
> in my system spin up. I examined the code and it only uses the 'open' call
> to create file descriptors. So I wrote a tiny test program:
>

---8<---

>
> PPS Win2K

One thing I find is that XP keeps waking up my CDROMS just to check
something is there. What's the whole point of Autorun then ? I have to keep
a CD in both of the drives otherwise XP locks up the system for about 15
seconds and then returns control for about 10 seconds before locking up
again. Sigh... I gonna have to get around to re-installing Linux. ;^)

Richard
--
------------------------------------------------------------------------
CATGACGCACTAGCGGATTCCAATCGGGTAGTTCCCCCCGCGCACTTATGCCTCAATAGATCTGCCACATCG
CATGGTGATCATCCCATTCTTCGCCCGGGATATCTTAAGCAATGGGGGAAGTGTGGCATCCTTTTGCTTCAG
dna.pl v0.2.4 (c) 20020613                    (tm) rth @ mibnet.plus.com


- Raw text -


  webmaster     delorie software   privacy  
  Copyright © 2019   by DJ Delorie     Updated Jul 2019